Journal:

Article Title: Cytochrome c 3 Mutants of Desulfovibrio desulfuricans

doi:

Figure Lengend Snippet: Diagrammatic representation of the D. desulfuricans G20 chromosome region encoding cycA. (A) Arrangement of genes in wild-type genomic DNA. The vertical arrow indicates the position of a putative promoter. The black bar indicates the position of a putative ORF upstream of cycA that is transcribed left to right, as is cycA in this illustration. t1 and t2 indicate the locations of possible transcriptional terminators. (B) Plasmid pBSC2 (Table ​(Table1)1) used for gene disruption. The SacII-PstI internal cycA fragment is designated ‘cycA’. (C) Plasmid-interrupted chromosomal cycA. The positions of PCR and sequencing primers, B1 cyc primer and Km primer for the leftward junction and T3 primer and cyc2 left primer for the rightward junction, are indicated by arrows. The left copy of cycA lacks 63 bp of the 3′ end of the coding sequence (which totals 393 bp), while the right copy lacks 71 bp of the 5′ end. Note the different scale for panel A versus that for panels B and C.

Article Snippet: When a PCR product was not obtained with these primers, the DNA from the putative mutant was digested with Sac II (Fig. C) and recircularized to generate a Km r Ap r plasmid, and the cycA gene was sequenced from the T3 primer (Promega).

Techniques: Plasmid Preparation, Sequencing

Journal: The Journal of Experimental Medicine

Article Title: Combination of quadruplex qPCR and next-generation sequencing for qualitative and quantitative analysis of the HIV-1 latent reservoir

doi: 10.1084/jem.20190896

Figure Lengend Snippet: Q4PCR approach. Schematic representation of the Q4PCR protocol. Genomic DNA from CD4 + T cells was subjected to limiting dilution qPCR with a gag -specific primer/probe set to determine overall HIV-1 proviral frequency. NFL proviral genomes were amplified from CD4 + T cell genomic DNA in samples diluted to single-copy concentrations based on gag qPCR. An aliquot of the resulting amplicons was assayed by Q4PCR using a combination of primer/probe sets covering PS, gag , pol , and en v. Samples with positive signal for any combination of at least two primer/probe sets were collected and subjected to nested NFL PCR, library preparation, and next-generation sequencing.

Article Snippet: HIV-1–specific primers and a probe targeting a conserved region in gag were used in a limiting dilution qPCR reaction (forward primer, 5′-ATG​TTT​TCA​GCA​TTA​TCA​GAA​GGA-3′; internal probe, 5′-/6-FAM/CCACCCCAC/ZEN/AAGATTTAAACACCATGCTAA/3′/IABkFQ/; reverse primer, 5′-TGC​TTG​ATG​TCC​CCC​CAC​T-3′; Integrated DNA Technologies; ).

Techniques: Amplification, Next-Generation Sequencing

Journal: The Journal of Experimental Medicine

Article Title: Combination of quadruplex qPCR and next-generation sequencing for qualitative and quantitative analysis of the HIV-1 latent reservoir

doi: 10.1084/jem.20190896

Figure Lengend Snippet: Quantitative analysis. (A) Frequency per million CD4 + T cells of gag + proviruses amplified from genomic DNA and samples with any one, two, three, or all four qPCR probe signals after NFL amplification for the preinfusion (wk−2) and week 12 (wk12) time points. Horizontal bars indicate median values. For patient 9242, the frequency of env + proviruses amplified from genomic DNA per million CD4 + T cells is plotted due to limited gag + amplification signal. (B) Comparison of frequencies of inducible proviruses (Q 2 VOA), intact proviruses obtained with NFL sequencing strategy (NFL intact), and intact proviruses identified with Q4PCR (Q4PCR intact) at preinfusion and week 12 time points for the same samples ( ; ). (C) Pearson correlation between frequency of intact proviruses identified with Q4PCR and inducible proviruses measured by Q 2 VOA at preinfusion and week 12 time points ( ; ). Participant 9254 was excluded from the quantitative analysis because of inadequate sample availability. Individual patients are depicted in different colors. Time points are represented by circles and triangles for week −2 and week 12, respectively.

Article Snippet: HIV-1–specific primers and a probe targeting a conserved region in gag were used in a limiting dilution qPCR reaction (forward primer, 5′-ATG​TTT​TCA​GCA​TTA​TCA​GAA​GGA-3′; internal probe, 5′-/6-FAM/CCACCCCAC/ZEN/AAGATTTAAACACCATGCTAA/3′/IABkFQ/; reverse primer, 5′-TGC​TTG​ATG​TCC​CCC​CAC​T-3′; Integrated DNA Technologies; ).

Techniques: Amplification, Sequencing